Monogenic conditions are health issues caused by changes in a single gene. They usually follow a clear pattern of inheritance and can significantly increase the risk of disease. On the other hand, polygenic and multifactorial conditions result from the combined effect of many different genes, each adding a little risk. These conditions do not follow simple inheritance patterns and are often common diseases influenced by both genetics and environmental factors. Genetic testing can provide more cl
Monogenic conditions are health issues caused by changes in a sin…
16 views1 month ago
FacebookDr. Irman Genetics
What is the difference between a monogenic disorder and a polygenic disorder?
What is the difference between a monogenic disorder and a polyge…
5.2K views8 months ago
askfilo.com
Overview and Strategies to Diagnose Monogenic Diabetes
Overview and Strategies to Diagnose Monogenic Diabetes
433 viewsAug 11, 2022
vumedi.com
From pathophysiology to treatment of monogenic diseases (3)
From pathophysiology to treatment of monogenic diseases (3)
Aug 16, 2010
college-de-france.fr
SOLVED: A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell anemia is caused by a mutation in the HBB gene, which codes for the B-globin chain of hemoglobin. The beginning of HBB is shown here: 5' ATGGTGCACCTGACTCCTGA GGAGAAGTCTGCCGTTACT.A. Translate this HBB sequence into an amino acid sequence.B. In terms of amino acids, what is the result of the sickle cell mutation, wherein the bolded red A is changed to a T? This single mutation causes hemoglobi
SOLVED: A monogenic disease is a disease caused by a mutation in a …
2 months ago
numerade.com
What are Single Gene Disorders?
What are Single Gene Disorders?
Jan 28, 2010
news-medical.net
Answered: A particular monogenic trait has 5 different variants. Explain how you might determine the inheritance pattern for these variants. Be sure to include how you… | bartleby
Answered: A particular monogenic trait has 5 different variants. Expla…
Feb 1, 2020
bartleby.com
7:33
Monosomy | Definition, Causes & Examples
48K viewsOct 12, 2015
Study.com
3:40
What Monogenic Diseases Can PGD Diagnose? - Everyday Bioethics E…
3 months ago
YouTubeEveryday Bioethics Expert
3:33
Do Polygenic Traits Determine Disease Susceptibility?
1 month ago
YouTubeThe Operating Table
2:53
What Is Monogenic Diabetes And How Is It Genetic? - Genetic Welln…
1 month ago
YouTubeGenetic Wellness for Families
3:02
Are Monogenic Disorders A Cause Of Stroke? - Stroke Support Channel
3 views2 months ago
YouTubeStroke Support Channel
4:10
Monogenic Diabetes : When Type 2 Is Actually a Gene Variant
243 views2 weeks ago
YouTubeMedical Centric Podcast
2:26
What Is Monogenic Hypertension And Genetic Risk? - Hypertension …
1 month ago
YouTubeHypertension Help Hub
2:40
Is Monogenic Hypertension A Genetic Cause Of High BP? - Hype…
1 month ago
YouTubeHypertension Help Hub
4:12
What Causes Monogenic Diabetes Genetically? - Genetic Wellness fo…
1 views1 month ago
YouTubeGenetic Wellness for Families
3:05
Is Monogenic Diabetes Different From Type 1 Diabetes? - Genetic …
1 month ago
YouTubeGenetic Wellness for Families
2:39
"Net Anthropology series monogenic disorders"#anthropolo…
12 views2 months ago
YouTubeThe AnthroLens
3:57
How Is a Single-Gene Disorder Genetically Identified?
3 weeks ago
YouTubeBiology for Everyone
3:24
How Does PGD Work For Monogenic Diseases? - Everyday …
3 months ago
YouTubeEveryday Bioethics Expert
3:03
What Is The Difference Between Monogenic And Polygenic Arthriti…
2 views1 month ago
YouTubeThe Arthritis Fix
3:40
How Do Scientists Identify Monogenic Disorders Using Genet…
1 views3 weeks ago
YouTubeBiology for Everyone
2:58
Are Monogenic And Polygenic Arthritis Inherited Differently? - Th…
1 month ago
YouTubeThe Arthritis Fix
0:10
Understanding Mono: My Experience with Undiagnosed Illn…
9.5K views8 months ago
TikTokvenuszes
Discovery of New Type of Monogenic Diabetes | Dr V Mohan
20.2K views6 months ago
YouTubeDr V Mohan
Multifactorial Inheritance
NATIONALLY RATED HOSPITAL
About this channel
YouTubeChildren's National Hospital
Monogenic Disorders | Virtual Lab
910 viewsAug 25, 2022
YouTubeLabster
9:06
What is Monogenic Diabetes? | Dr V Mohan
11.8K viewsNov 14, 2021
YouTubeDr V Mohan
Monogenic insulin resistance – diagnosis, treatment, and insight…
205 viewsNov 9, 2022
YouTubeEndo-ERN
4:24
Polygenic inheritance
78.1K viewsNov 4, 2014
YouTubeShomu's Biology
See more videos
Static thumbnail place holder